Gut Microbiota Dysbiosis in Lupus Nephritis
NCT06231303 · Status: NOT_YET_RECRUITING · Type: OBSERVATIONAL · Enrollment: 60
Last updated 2024-01-30
Summary
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Conditions
- Gut Microbiota Dysbiosis in Lupus Nepheritis
Interventions
- GENETIC
-
DNA extraction and PCR amplification
Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer. The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows: Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s. Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.
Sponsors & Collaborators
-
Hager Zanaty
lead OTHER
Eligibility
- Min Age
- 18 Years
- Max Age
- 50 Years
- Sex
- FEMALE
- Healthy Volunteers
- No
Timeline & Regulatory
- Start
- 2025-01-31
- Primary Completion
- 2026-06-30
- Completion
- 2026-12-31
More Related Trials
-
Searching for Diagnostic/Prognostic Biomarkers in SLE With Renal Involvement by Proteomic Techniques
NCT03687138 ·Status: COMPLETED
-
Screening Biomarkers for Severe Lupus Based on Multi-omics Studies
NCT05539001 ·Status: UNKNOWN
-
Disease Progression and Activity in Patients With Systemic Lupus Erythematosus
NCT00339261 ·Status: COMPLETED
-
Disease Activity Biomarkers in Patients With Systemic Lupus Erythematosus
NCT05443516 ·Status: RECRUITING
-
A Study of Skin and Systemic Biomarkers In Patients With Active Cutaneous Lupus Erythematosus And In Healthy Volunteers
NCT02034344 ·Status: COMPLETED
-
Renal Resistive Index as a Marker of Severity and Treatment Outcomes in Lupus Nephritis
NCT03958851 ·Status: UNKNOWN
-
Renal Survival in Patients with Lupus Nephritis
NCT06588192 ·Status: NOT_YET_RECRUITING
-
A Clinical Trial to Evaluate Safety of Gusacitinib in Patients With Systemic Lupus Erythematosus (SLE) or Lupus
NCT06238531 ·Status: WITHDRAWN ·Phase: PHASE1
-
A Study to Learn More About the Safety and Effects of Felzartamab in Adults With Lupus Nephritis Aged 18 to 75 Years Old
NCT06064929 ·Status: COMPLETED ·Phase: PHASE1
-
Prediction of Outcome of Lupus Nephritis
NCT02403115 ·Status: UNKNOWN
-
Minimizing Glucocorticoid Administration in Patients With Proliferative Lupus Nephritis
NCT05207358 ·Status: RECRUITING ·Phase: PHASE4
-
T Regulatory Cells IN LUPUS NEPHRITIS
NCT06428539 ·Status: NOT_YET_RECRUITING
-
Assessment of Cognitive Function and Gut Microbiota Analysis in Real World Patients With Lupus Cerebrovascular Disease
NCT05636670 ·Status: UNKNOWN
-
This Project Aims to Understand the Needs of Rheumatologists and Other Specialties in the Care of Patients With SLE
NCT06698900 ·Status: COMPLETED
-
An Efficacy and Safety Study of CNTO 136 in Patients With Active Lupus Nephritis
NCT01273389 ·Status: COMPLETED ·Phase: PHASE2
-
Predictors of Remission and Renal Outcomes in Lupus Nephritis in Assuit University Hospitals.
NCT06228222 ·Status: NOT_YET_RECRUITING
-
Predictors of Bone Mineral Density in Lupus Nephritis Activity
NCT06837558 ·Status: NOT_YET_RECRUITING
-
Serologically Active, Clinically Stable Systemic Lupus Erythematosus
NCT00000421 ·Status: COMPLETED ·Phase: PHASE2
-
Autophagy in Systemic Lupus Erythematosus
NCT03583853 ·Status: UNKNOWN
-
Epigenetics in Lupus Nephritis
NCT04648059 ·Status: UNKNOWN
-
Study of the Role of Soluble Forms of RAGE (sRAGE/esRAGE) as Diagnostic and Prognostic Biomarkers of Systemic Lupus Erythematosus.
NCT02891213 ·Status: UNKNOWN
-
Autoimmunity in Sisters of Lupus Patients
NCT01076101 ·Status: COMPLETED
-
Renal Arterial Resistive Index as a Noninvasive Biomarker of Disease Activity in Lupus Nephritis Patients
NCT06631404 ·Status: RECRUITING
-
A Clinical Study of CD19 Universal CAR-γδT Cells in Active Systemic Lupus Erythematosus
NCT06106893 ·Status: RECRUITING ·Phase: PHASE1/PHASE2
-
Lupus Nephritis Biomarker Study: Baseline Characteristics of Patients
NCT01470183 ·Status: COMPLETED